versarray chipwriter pro robotic arrayer (Bio-Rad)
Bio-Rad is a verified supplier 
Bio-Rad manufactures this product 
90
Structured Review
Bio-Rad
versarray chipwriter pro robotic arrayer
Versarray Chipwriter Pro Robotic Arrayer, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/versarray+chipwriter+pro+system/versarray+chipwriter+pro/pmc03392818-99-20-25
Average 90 stars, based on 1 article reviews
Versarray Chipwriter Pro Robotic Arrayer, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/versarray+chipwriter+pro+system/versarray+chipwriter+pro/pmc03392818-99-20-25
Average 90 stars, based on 1 article reviews
versarray chipwriter pro robotic arrayer - by Bioz Stars,
2026-10
90/100 stars
Images
Related Articles
Amplification:Article Title: Sensitivity and resistance towards isoliquiritigenin, doxorubicin and methotrexate in T cell acute lymphoblastic leukaemia cell lines by pharmacogenomics. Article Snippet: The development of drug resistance in cancer cells necessitates the identification of novel agents with improved activity towards cancer cells.. In the present investigation, we compared the cytotoxicity of the chalcone flavonoide, isoliquiritigenin (ISL), with that of doxorubicin (DOX) and methotrexate (MTX) in five T cell acute lymphoblastic leukaemia (T-ALL) cell lines (Jurkat, J-Jhan, J16, HUT78 and Karpas 45).. To gain insight into the molecular mechanisms which determine the response of T-ALL cells towards ISL, DOX and MTX, we applied array-based matrix comparative genomic hybridisation and microarray-based mRNA expression profiling and compared the genomic and transcriptomic profiles of the cell lines with their 50% inhibition (IC50) values for these three drugs. Polymerase Chain Reaction:Article Title: Sensitivity and resistance towards isoliquiritigenin, doxorubicin and methotrexate in T cell acute lymphoblastic leukaemia cell lines by pharmacogenomics. Article Snippet: The development of drug resistance in cancer cells necessitates the identification of novel agents with improved activity towards cancer cells.. In the present investigation, we compared the cytotoxicity of the chalcone flavonoide, isoliquiritigenin (ISL), with that of doxorubicin (DOX) and methotrexate (MTX) in five T cell acute lymphoblastic leukaemia (T-ALL) cell lines (Jurkat, J-Jhan, J16, HUT78 and Karpas 45).. To gain insight into the molecular mechanisms which determine the response of T-ALL cells towards ISL, DOX and MTX, we applied array-based matrix comparative genomic hybridisation and microarray-based mRNA expression profiling and compared the genomic and transcriptomic profiles of the cell lines with their 50% inhibition (IC50) values for these three drugs. Sequencing:Article Title: Use of photopolymerization for amplification and detection of a Molecular Recognition Event Article Snippet: .. An oligonucleotide sequence (5′ amino—CATCACACAACATCACACAACATCACGTATATAAAACGGAACGTCGAAGG-3′ TEG biotin) (Operon) was spotted at an overall concentration of 20 μM on aldehyde substrates in the spotting buffer (3×SSC, 0.05% SDS) using a Concentration Assay:Article Title: Use of photopolymerization for amplification and detection of a Molecular Recognition Event Article Snippet: .. An oligonucleotide sequence (5′ amino—CATCACACAACATCACACAACATCACGTATATAAAACGGAACGTCGAAGG-3′ TEG biotin) (Operon) was spotted at an overall concentration of 20 μM on aldehyde substrates in the spotting buffer (3×SSC, 0.05% SDS) using a Microarray:Article Title: Circulating microRNA expression profile: a novel potential predictor for chronic nervous lesions. Article Snippet: Yongming Xu1, Xin Zhang1, Shaofeng Pu1, Junzhen Wu2, Yingying Lv1, and Dongping Du1* Pain Management Center and Department of Anesthesiology, Shanghai Sixth People’s Hospital Affiliated to Shanghai Jiaotong University, Shanghai 200233, China Department of Anesthesiology, Shanghai Sixth People’s Hospital Affiliated to Shanghai Jiaotong University, Shanghai 200233, China *Correspondence address.. Tel: þ 86-21-64369181-8896; Fax: þ 86-21-64368920; E-mail: dudongping@hotmail.com Article Title: Comparative study of microRNA profiling in keloid fibroblast and annotation of differential expressed microRNAs. Article Snippet: Chao Li1, Yuehong Bai1, Hua Liu2, Xuemei Zuo3, Haichang Yao1, Yiming Xu1, and Manlin Cao1* Department of Rehabilitation Medicine, Shanghai Sixth People’s Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai 200233, China Department of Clinical Laboratory, Shanghai Sixth People’s Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai 200233, China Department of Clinical Laboratory, Shanghai Changning Center Hospital, Shanghai 200336, China These authors contributed equally to this work.. *Correspondence address.. Tel: þ86-21-64369181; Fax: þ86-21-63701361; E-mail: c_ml2009@hotmail.com |